[#293058] Hello, world? (#158) — Matthew D Moss <matthew.moss@...>
The three rules of Ruby Quiz 2:
Here's all I came up with:
[#293063] Array#find! — Trans <transfire@...>
How to remove the first occurrence of something?
[#293075] Scan HTML — Tom Arra <turtleman14789@...>
So I am new to Ruby scripting so I am not sure if this is possible or
[#293081] Ara's main gem: validation with error message — Pe, Botp <botp@...>
Hi,
[#293113] a practical Lisp in Ruby — "Elliott Hird" <penguinofthegods@...>
Hi! I've been working on a Lisp interpreter in Ruby that is fully
This is a VERY interesting idea, but why do you want to do this?
[#293136] counting in for .. in .. — Daniel Liebig <d.liebig@...>
Hi,
[#293141] Patterns for error messages — "Victor 'Zverok' Shepelev" <vshepelev@...>
Hello all.
Alle Saturday 01 March 2008, Victor 'Zverok' Shepelev ha scritto:
>From: Stefano Crocco [mailto:stefano.crocco@alice.it]
Alle Monday 03 March 2008, Victor 'Zverok' Shepelev ha scritto:
From: Stefano Crocco [mailto:stefano.crocco@alice.it]
Alle Monday 03 March 2008, Victor 'Zverok' Shepelev ha scritto:
[#293153] Ruby in windows — "lance.sanchez@..." <lance.sanchez@...>
i'm trying to script administrative tasks in windows and i'm really
[#293156] nobody knows shoes, in pdf and html — _why <why@...>
Many hellos. Just a small footnote to add to this vast catalogue of
On Sun, Mar 2, 2008 at 3:18 PM, _why <why@ruby-lang.org> wrote:
On Mon, Mar 03, 2008 at 12:52:18AM +0900, botp wrote:
Thanks for the book _why. Is there a place where I could download
[#293164] Qt-question: How to react on a click on a table-cell? — Adna rim <adnarim@...>
Hi,
[#293178] Re: What should this print? — Ken Bloom <kbloom@...>
On Sun, 02 Mar 2008 05:04:47 +0000, Bouquet wrote:
[#293181] Ruby tools to develop compilers — Le Lann Jean-Christophe <jean-christophe.lelann@...>
Hi,
[#293191] sudo gem update --system Takes Greater Than A Minute — Brian Puccio <brian@...>
Hi everyone,
[#293195] How do I get the server name? — "laredotornado@..." <laredotornado@...>
Hi,
Since ENV is a hash, why don't you open up irb and type
Andrei Maxim wrote:
On Sun, Mar 2, 2008 at 11:00 PM, Sebastian Hungerecker
[#293206] Building your own string sorting method — "Joseph L. Casale" <jcasale@...>
I am trying to find examples of this to help me but can't seem to locate any on the web. Anyone know of any online examples? I know ruby has a built in method for sorting an array, but it's part of a tutorial...
[#293228] Ruby Extension Code in C, GC Question — Pie Squared <PieSquared@...>
[#293248] Split the string — Sijo Kg <sijo@...>
I have a string
On 3/3/08, Sijo Kg <sijo@maxxion.com> wrote:
[#293262] Complete Serialization Options — Demonic Software <demonic.software@...>
Is there a way to *completely* serialize objects and move them to
[#293265] Understanding ruby classes — Damjan Rems <d_rems@...>
On Mon, Mar 3, 2008 at 9:07 AM, Damjan Rems <d_rems@yahoo.com> wrote:
[#293272] qtruby4 license — Christian Kerth <christian.kerth@...>
Hey!
On Mar 3, 9:20 am, Christian Kerth <christian.ke...@dynamicmedia.at>
[#293275] Dealing with nil — "Robert Klemme" <shortcutter@...>
Hi,
[#293276] Typecast — Sijo Kg <sijo@...>
Hi
[#293307] Normal For Loop — Cory Cory <cg821105@...>
I'm new to Ruby. Is there such thing as a C++ style (and most others)
I understand that all of these for-each style loops are available, but I
[#293327] Class and inheritance — August0866 <august0866@...>
Hi All,
On Mar 5, 4:36 am, Todd Benson <caduce...@gmail.com> wrote:
OK, 2 dumb questions What is the difference between a class and a
[#293350] net-ldap and OpenSSL — "Glen Holcomb" <damnbigman@...>
I am having trouble making an SSL connection to an LDAP server. After
[#293357] Loading a file in a buffer... — Zangief Ief <z4n9ief@...>
Hello everybody,
[#293376] Bug in regex engine ?? Must be... — "D. Krmpotic" <david.krmpotic@...>
Hi,
[#293399] Why is this not implemented in Ruby — Damjan Rems <d_rems@...>
Show me a language that does allow you to do this, I've never seen it.
[#293404] Getting a field value in a form with ruby — Mark Mr <pimea.mark@...>
Hi guys. I have a form to submit an assessment for one of my web apps.
[#293407] Question on the Ruby Programming Language Book — Bharat Ruparel <bruparel@...>
I have been reading The Ruby Programming Language book by David Flanagan
Hello Bill,
Bharat Ruparel wrote:
[#293424] String to Object name? — "Mariko C." <lessthaneloquent@...>
I'd like to change a string, for example, "something" and turn it into
[#293445] Better performance than native unix commands? — Ma Sa <ntwrkd@...>
I have an issue with nfs and listing a large amount of files that I am
Ma Sa wrote:
On Mon, Mar 3, 2008 at 10:21 PM, Markus Arike <marike1@optonline.net> wrote:
If you just need to list the name of the files, du is faster than ls
[#293468] and statement — loveajax@...
Hi,
[#293475] problems closing a CD — Tom Cloyd <tomcloyd@...>
I'm utterly baffled by this simple problem in a ruby program I've run a
[#293484] jruby vs mri memory management — "Michal Suchanek" <hramrach@...>
Hello
Michal Suchanek wrote:
[#293493] Re: The Ruby Programming Language - what are your thoughts? — coigner <coignerATgmail@...>
On Mon, 03 Mar 2008 22:04:55 -0500, Esmail wrote:
Esmail wrote:
Dave Thomas wrote:
On Mar 9, 2008, at 7:46 PM, Clifford Heath wrote:
James Gray wrote:
Clifford Heath wrote:
On Mar 11, 2008, at 3:11 AM, Tom Cloyd wrote:
James Gray wrote:
On Wed, Mar 12, 2008 at 4:55 AM, Clifford Heath <no@spam.please.net> wrote:
Andrei Maxim wrote:
[#293497] Cloning a module and isolating it from the clone — Earle Clubb <eclubb@...>
I'm trying to find a way to create a copy of a module and then sever all
Earle Clubb wrote:
[#293506] Zed Shaw on Ruby Pros/Cons: You Used Ruby to Write WHAT? — estherschindler <esther@...>
At CIO.com:
On Tue, Mar 4, 2008 at 7:20 AM, estherschindler <esther@bitranch.com> wrote:
[#293509] Samizdat 0.6.1: Security, MVC, RSS import — "Dmitry Borodaenko" <angdraug@...>
What is Samizdat?
[#293531] Managing Windows from Linux via Ruby — "Glen Holcomb" <damnbigman@...>
Does anyone know of a reliable way to manage resources on Windows machines
On Tue, Mar 4, 2008 at 11:14 AM, Glen Holcomb <damnbigman@gmail.com> wrote:
On Tue, Mar 4, 2008 at 2:22 PM, Martin DeMello <martindemello@gmail.com>
[#293532] Continous integration and watir — Emil Sandin <esandin@...>
Has anyone set up a Continous integration server running watir tests?
[#293551] Inspecting a block given to a method — "Thomas Mueller" <thomasmueller76@...>
Hi,
On Tue, Mar 4, 2008 at 3:00 PM, Thomas Mueller
Thanks for your quick reply. If I understand you correctly that would
[#293569] Newbea question again? — Ibrahim Dogru <casid3@...>
Hello Ruby Developers,
On Tue, Mar 4, 2008 at 10:29 PM, Ibrahim Dogru <casid3@lycos.com> wrote:
[#293579] Meta Programming Question — MohsinHijazee <mohsinhijazee@...>
Hello!
[#293588] multithreading sysread error — Venkat Bagam <bagam_venkat@...>
Hi All,
[#293601] collect with index? — Tim Conner <plump4651@...>
simple question: how can I do a collect with index? This should be
[#293632] Is there a difference between load "file" and eval content — Damjan Rems <d_rems@...>
[#293636] How to create a class in callers context?? — DMisener <DAMisener@...>
Here's a simple example of my predicament:
[#293645] OpenSSL/SOAP - keystore/truststore — Christopher Wilson <christopher@...>
I am attempting to connect to a secure SOAP web service and have been
[#293651] Too many open files on OpenBSD — Edd Barrett <vext01@...>
Hi,
[#293662] Too slow — "coolgeng coolgeng" <coolgeng410@...>
Hi,
[#293668] Best practices for Ruby Meta-programming — harshal <harshal.hayat@...>
Dear all,
[#293669] Is these possible with ruby? — Ratnavel Sundaramurthi <ratnavelps@...>
Can we do any of theses (from RoR):
[#293680] Erratic result — "coolgeng coolgeng" <coolgeng410@...>
Hi
[#293685] Dir#.glob over accentuated named directories ??? — unbewusst.sein@... (Une B騅ue)
over MacOS X the user could have named directories using accentuated
[#293697] Ruby Basics / define met;hod — Chinna Karuppan <chinnakaruppan@...>
Hi,
2008/3/6, Chinna Karuppan <chinnakaruppan@gmail.com>:
[#293708] the value in ensure block is not returned — Oliver Peng <oliver.peng@...>
Here is the sample code:
[#293715] duplicating characters in a string — Adam Akhtar <adamtemporary@...>
If i have a string "abc" and want to make it like this "aabbcc", how do
Adam Akhtar wrote:
Tim Hunter wrote:
Adam Akhtar wrote:
7stud -- wrote:
Rodrigo Bermejo wrote:
2008/3/6, Joel VanderWerf <vjoel@path.berkeley.edu>:
[#293740] Double colon vs module block — Daniel Mendler <dmendler@...>
Hi!
[#293757] IO#Foreach -- Max line length — Tristin Davis <tristin.colby@...>
I'm trying to emulate the new feature in 1.9 that allows you to specify
Tristin Davis wrote:
But by the time you actually get count, isn't the line already read in
On Behalf Of Tristin Davis:
On 3/6/08, Pe, Botp <botp@delmonte-phil.com> wrote:
Thanks for the ideas Adam. I thought someone might be able to use it so
Tristin Davis wrote:
[#293760] Reading pick from option menu — Isaac Toothyxdip <toothyxdip@...>
words = ['-', 'cm', 'mm', 'ml']
On Mar 6, 2008, at 4:44 PM, Isaac Toothyxdip wrote:
Wow this is VERY helpful and im going look over and run it (it looks
On Mar 9, 2008, at 9:28 PM, Isaac Toothyxdip wrote:
[#293802] ruby email libraries — testautomated6@...
Hi,
[#293809] Dynamic class thingies? (Okay, not sure how to title this one) — coigner <coignerATgmail@...>
Asking for ideas here but let me preface...
[#293826] Ruby equivalence for php include("file.php"); — Miquel Oliete <ktalanet@...>
Hi there
Miquel Oliete wrote:
On Sat, 8 Mar 2008 02:27:37 +0900
[#293841] ActiveSupport Enumerable#sum should not use #size — Trans <transfire@...>
ActiveSupport defines this for Enumerable#sum:
[#293842] instance_eval and class_eval - names got mixed up? — Bharat Ruparel <bruparel@...>
Going through the Ruby Programming Language text Chapter 8 Reflection
2008/3/7, Bharat Ruparel <bruparel@mercury.com>:
[#293860] do-end-blocks — Daniel Mendler <dmendler@...>
Hi!
On Fri, Mar 7, 2008 at 6:32 PM, Daniel Mendler <dmendler@wurzelteiler.de> wrote:
[#293864] fattr-1.0.2 — ara howard <ara.t.howard@...>
[#293877] Creating a search — Tom Ha <tom999@...>
Hi there,
[#293882] Apple's "Discover Rails in Leopard" doesn't work for me. Any help welcome ! — Thierry Jeanneret <thierry.jeanneret@...>
Hello There,
[#293900] ANN: doodle 0.0.1 — "Sean O'Halpin" <sean.ohalpin@...>
Doodle is a Ruby library and gem for simplifying the definition of
[#293902] A question on singleton methods — mike leonard <mikeleonard@...>
Hello,
unsubscribe
[#293909] bin2str conversion — Zangief Ief <z4n9ief@...>
Hello,
[#293922] lost gems - path problem? — Tom Cloyd <tomcloyd@...>
I'm a little unsure where to ask this question. If I need to go
Tom Cloyd wrote:
On Sun, Mar 9, 2008 at 7:03 AM, Tom Cloyd <tomcloyd@comcast.net> wrote:
Todd,
Well, reinstalling (after a purge) didn't do the trick at all. I'm a bit
[#293927] Trac - Does it make sense to keep http://trac.edgewall.org/ticket/4315 open? — Ilias Lazaridis <ilias@...>
Response to message [1] on trac.devel (as I cannot write there, due to
On Mar 9, 2:13m, Phillip Gawlowski <cmdjackr...@googlemail.com>
On Mar 9, 2008, at 7:29 AM, Ilias Lazaridis wrote:
On Mar 9, 12:20m, Arlen Cuss <cel...@sairyx.org> wrote:
[#293936] Redefine a class with same name — Martin Boese <boesemar@...>
[#293956] Determine "owning" class? — dkmd_nielsen <donn@...>
class A
[#293974] Keyword arguments for WIN32OLE? — djlewis <djlewis@...>
Is there a way to pass ~keyword~ arguments to a WIN32OLE method in
[#293975] passing procs around in variables — Nathan <njmacinnes@...>
Hi,
[#293986] Offering to work directly for the Ruby community! — Gregory Brown <gregory.t.brown@...>
Hi folks,
On Mar 10, 5:17 am, Thomas Wieczorek <wieczo...@googlemail.com> wrote:
On Tue, Mar 11, 2008 at 12:15:12AM +0900, Gregory Brown wrote:
FWIT, I've seen python sites which list programmers wanting to do
[#293996] Re: Best practices for Ruby Meta-programming — John Carter <john.carter@...>
On Thu, 6 Mar 2008, harshal wrote:
On Mon, Mar 10, 2008 at 4:06 AM, John Carter <john.carter@tait.co.nz> wrote:
On Mon, 10 Mar 2008, Robert Dober wrote:
On Tue, Mar 11, 2008 at 5:31 AM, John Carter <john.carter@tait.co.nz> wrote:
On Mon, Mar 10, 2008 at 8:11 AM, Robert Dober <robert.dober@gmail.com> wrote:
[#293999] Reding unicode characters? — dare ruby <martin@...>
Hi friends,
dare ruby wrote:
On Mar 10, 2008, at 10:00 AM, 7stud -- wrote:
James Gray wrote:
[#294015] newbie question — Frantisek Psotka <frantisek.psotka@...>
is in ruby operator for:
On Mar 10, 11:50 am, Farrel Lifson <farrel.lif...@gmail.com> wrote:
[#294019] How to get and set the proxy of IE? — Wu Junchen <wujunchen@...>
I want to let my program connect to internet using the proxy setting of
[#294034] Getting files out of a .tar.gz archive — celldee <celldee@...>
Hi,
On Mon, Mar 10, 2008 at 9:09 AM, celldee <celldee@gmail.com> wrote:
Hi Daniel,
On Mon, Mar 10, 2008 at 12:43 PM, celldee <celldee@gmail.com> wrote:
[#294036] C / C++ extensions: need all the tips/tricks you can give me — Emmanuel Oga <oga_emmanuel_oga@...>
Hi!
[#294054] Sort hashes using values — Subbu <subramani.athikunte@...>
Ruby automatically sorts hashes by keys, which means:
[#294059] Which is better -- method option or multiple methods? — Trans <transfire@...>
In the case of limited options, like the following example, which is
Trans wrote:
2008/3/10, Trans <transfire@gmail.com>:
Method options are better if you ever want to extend it. I personally
[#294075] Rake TestTask screwing with global variables? — Drew Olson <olsonas@...>
I've got a rake TestTask that I have set a global variable in specific
[#294081] Re: shortcut for x = [x] unless x.is_a?(Array) — Siep Korteling <s.korteling@...>
Aryk Grosz wrote:
On Mon, Mar 10, 2008 at 5:57 PM, Siep Korteling <s.korteling@gmail.com> wrote:
On Mon, Mar 10, 2008 at 6:16 PM, Paul Mckibbin <pmckibbin@gmail.com> wrote:
[#294090] Setting Focus on Console Window — Hayato Iriumi <hiriumi@...>
Hello,
[#294111] setting local variables via eval — ara howard <ara.t.howard@...>
On Tue, Mar 11, 2008 at 5:20 AM, ara howard <ara.t.howard@gmail.com> wrote:
On 3/11/08, ara howard <ara.t.howard@gmail.com> wrote:
[#294117] is this a feature or a bug? — Rie! <ariekusumaatmaja2@...>
sorry if it's been discussed as i don't know what the search keyword
[#294122] newbie question regarding memory leak — Venkat Bagam <bagam_venkat@...>
Hi, Recently, I have written a ruby program for web-scraping. But its a
On Tue, Mar 11, 2008 at 1:33 AM, Venkat Bagam <bagam_venkat@hotmail.com> wrote:
[#294127] Ordered Collection — Peter Hug <pete@...>
If class X has a method <=>(aX), I can sort an Array containing
[#294140] Combinatorics and permutations? Help? — David Palm <dvdplm@...>
Hi,
On Mar 11, 5:06 am, David Palm <dvd...@gmail.com> wrote:
On Tue, 11 Mar 2008 20:40:11 +0900, William James wrote:
[#294156] About updating gems — Manuel Montañés <el.padawer@...>
Hello everyone,
[#294174] ruby on windows — t3chn0n3rd <darrin_allen@...>
right now I am running ruby on red hat 8. Is there a compiler for
[#294189] The Best way to make my game multiplayer — Diego Bernardes <di3go.bernardes@...>
Hi guys, i have done a game in ruby using gosu, its a side scrolling
On 11 Mar 2008, at 20:18, Diego Bernardes wrote:
[#294192] whats the error here? — Adam Akhtar <adamtemporary@...>
My IDE (aptana rails) seems to complain about syntax with this code
Adam Akhtar wrote:
Sorry for the sloppy quoting of my code. Here it is in full. I made a
Just gone back to my ide and it aint underlining that line anymore
err on a similiar note if i have a hash like the one above and i do this
On Wed, Mar 12, 2008 at 12:03 AM, Adam Akhtar <adamtemporary@gmail.com> wrote:
Thank you both of you for you help. I was wondering how to create a
[#294210] Yet another Windows installer — Phillip Gawlowski <cmdjackryan@...>
Hello, list.
Since my reply seems to have been swallowed, the second try:
Sounds like it might be useful for those that want a "smaller install"
Roger Pack wrote:
James Tucker wrote:
James Tucker wrote:
On Sun, Mar 16, 2008 at 6:12 PM, Phillip Gawlowski
[#294220] Ruby Central matching Greg Brown donations, up to $5000! — "David A. Black" <dblack@...>
Hello all --
[#294224] "".to_a isn't consistent with "string".to_a — Clifford Heath <no@...>
I've just been tripped up by this behaviour, which I haven't
[#294231] sort array by some text — Ma Fe <frytaz@...>
Hi, i have array with file names
On Wed, Mar 12, 2008 at 12:02 AM, Ma Fe <frytaz@gmail.com> wrote:
well I dont know where in array i have .txt files but its sure that
On Wed, Mar 12, 2008 at 12:34 AM, Ma Fe <frytaz@gmail.com> wrote:
Ma Fe wrote:
On Wed, Mar 12, 2008 at 1:56 PM, 7stud -- <bbxx789_05ss@yahoo.com> wrote:
[#294236] Input using stdin — Nikhil Warade <newarade47@...>
How can I give input to a program using STDIN
[#294249] undefine instance var & [] (three questions) — Frantisek Psotka <frantisek.psotka@...>
Hi.
[#294261] Passing only a hash key, with no value, as an option — Max Williams <toastkid.williams@...>
I'm using the method of parameter passing where i have one 'regular'
[#294279] SOAP::RPC::StandaloneServer and WSDLs — Robert Gray <arg9000@...>
Robert Gray wrote:
[#294281] elsunless: Compiles but does not run. Standard? — Fred Talpiot <fredistic@...>
In Ruby:
2008/3/12, Fred Talpiot <fredistic@gmail.com>:
2008/3/12, Stefan Lang <perfectly.normal.hacker@gmail.com>:
Yup, you guys were right about ONE thing, the 'elsunless' was
[#294297] including general variables in modules — Mario Ruiz <mario@...>
I'm trying to create different scenarios so I thought to do something
On Mar 12, 2008, at 11:49 AM, Mario Ruiz wrote:
But I need it. :(
On Mar 12, 2008, at 12:17 PM, Mario Ruiz wrote:
so it's impossible to do it whithout declaring a method...
[#294310] My project Rgettext — "Mateusz Tybura" <wujciol@...>
Few days ago I wrote Rgetext my first project in Ruby. Could you try it and
[#294312] a method that checks if an object is in a range — wojtek@...4chu.net
Hi,
[#294322] Get OpenStruct attributes — Ed Hames <ehames@...>
Dear rubyists,
[#294334] mechanize 0.7.3 Released — Aaron Patterson <aaron@...>
mechanize version 0.7.3 has been released!
Aaron Patterson wrote:
[#294338] bug in Test Unit? — "Nasir Khan" <rubylearner@...>
In unit.rb with "ruby 1.8.6 (2007-03-13 patchlevel 0) [i386-mswin32]"
[#294351] Need help protecting data — Diego Bernardes <di3go.bernardes@...>
Hi
Diego Bernardes wrote:
[#294366] Parametric module or injecting code via class method? — Trans <transfire@...>
Which approach is better: parametric module or an injecting class
2008/3/13, Trans <transfire@gmail.com>:
On 13.03.2008 20:35, ara howard wrote:
On 14.03.2008 00:42, ara howard wrote:
On Sun, Mar 16, 2008 at 9:30 PM, Robert Klemme
On 17.03.2008 00:12, Sean O'Halpin wrote:
On Mon, Mar 17, 2008 at 9:14 AM, Robert Klemme
[#294367] minimal nntp client — Gerry Ford <wade@...>
I'm relatively new to ruby, having had one thread regarding commenting.
[#294368] Trouble capturing output of spawned process — Eric Marthinsen <emarthinsen@...>
Hello-
Eric Marthinsen wrote:
[#294387] Setting Class Methods Using Strings — "Demonic Software" <demonic.software@...>
Hello,
[#294393] autoinstall gems — S2 <email@...>
Is there a way to autoinstall a gem when it is "required" in an .rb file?
[#294404] Enumerator in ruby 1.9. — "Artem Voroztsov" <artem.voroztsov@...>
# One could write
[#294412] Operations with Time objects — Stefano Bortolotti <mxkefla@...>
Hi guys.
I have tried this:
[#294433] Threads, do_nanosleep and battery life — Mark Somerville <ms@...>
I'm writing a Ruby GTK application that runs on a mobile device (Nokia N800).
[#294451] Newbie:: HTTP request_get, how server side parses parameter and response? — Lauren <lun.zhenyu@...>
I have a simple server and client application. Client side uses
Before my message sinks, I found a website which provides some useful
[#294458] REXML Formatter issue - does each Element need formatting? — Wes Gamble <weyus@...>
All,
[#294466] File.size? incorrect for big files? — "Nation, Carey" <Carey.Nation@...>
Hi,
[#294481] use reqex to get the middle character and repeat it — Adam Akhtar <adamtemporary@...>
say i have the string "qxq" and i want to repeat the middle char 4 times
Don't use a regexp. It isn't clear what you want to happen if there isn't a middle character if the string has a odd integer for its length. Try using some type of substring approach such as this:
Hi --
On Fri, 14 Mar 2008, David A. Black wrote:
ahh why didnt i just think of that... str.gsub(/(\w)(x)(\w)/,
[#294490] script runs ok alone, broken pipe when piped to head? — "Dave Burns" <tburns@...>
Maybe I need to close the file or something?
[#294504] << : can some body check this code?? — Chinna Karuppan <chinnakaruppan@...>
why is it not working properly( weekly calendar)...
I think I found an answer not sure if it is normal way to do things....
[#294506] What is Ruby's biggest strength ? — Tuan Minh <tanthuyhoang85@...>
I'm learning Ruby an Rails.
On Thu, Mar 13, 2008 at 9:45 PM, Tuan Minh <tanthuyhoang85@yahoo.com> wrote:
Avdi Grimm wrote:
On 2008-03-14, Avdi Grimm <avdi@avdi.org> wrote:
> What helps Ruby stronger than other programming languages
Marc Heiler wrote:
So, you think this:
On Fri, Mar 14, 2008 at 6:05 PM, 7stud -- <bbxx789_05ss@yahoo.com> wrote:
On Mar 28, 2008, at 11:40 PM, Christopher Dicely wrote:
[#294512] Naming ruby class attribute and methods — "Demonic Software" <demonic.software@...>
Hello,
[#294522] Food Database (#159) — "Matthew Moss" <matthew.moss@...>
Note that because I am traveling tomorrow, I've posted this week's
[#294548] Closures 101 — jeffperforce@...
class Object
[#294552] MSSQL 2005 Stored Procedure? — Alexander Tretjakov <alex@...>
I want to programmig in Ruby... but have some problems.
[#294564] Robert's Ruby Riddle: Methodical Digits — "Robert Dober" <robert.dober@...>
Hi list
Robert Dober wrote:
On Sat, Mar 15, 2008 at 4:33 PM, Sebastian Hungerecker
Robert Dober wrote:
On Sat, Mar 15, 2008 at 1:38 PM, Sebastian Hungerecker
>
On Sun, Mar 16, 2008 at 7:45 AM, Robert Dober <robert.dober@gmail.com> wrote:
[#294573] How to Read Ruby API / Documentation — Chinna Karuppan <chinnakaruppan@...>
Hi,
I know there are methods like private_methods, protected_methods,
You will have to get used to the fact that the Ruby docs are horrible.
[#294584] installing C + Ruby extensions — "Gerardo Santana Gez Garrido" <gerardo.santana@...>
I'm using mkmf for building and installing a C extension. I'm also
[#294601] How to separate stdout & stderr from executed shell command — jqwoods@...
I would like to create a method which executes a given shell command
[#294609] need for singleton_methods — Chinna Karuppan <chinnakaruppan@...>
I have trying to learn about this class<<self;self;end and the
[#294645] how to abruptly end a program? — Tom Cloyd <tomcloyd@...>
I read in <Programming Ruby 2nd ed.> (p. 303) - ""If Ruby comes across a
Tom Cloyd wrote:
Joel VanderWerf wrote:
[#294648] standard library documentation — Tom Cloyd <tomcloyd@...>
An example of a puzzle I've run into many times before -
Tom Cloyd wrote:
From: Tom Cloyd [mailto:tomcloyd@comcast.net]
Pe wrote:
From: Tom Cloyd [mailto:tomcloyd@comcast.net]
Pe wrote:
[#294671] Error using FasterCSV — Glenn <glenn_ritz@...>
Hi,
[#294672] baffling undefined method error — Tom Cloyd <tomcloyd@...>
I'm getting an error I can't account for. In a method I've written I
Tom Cloyd wrote:
[#294693] How to make net-ping thread safe? — Laurent Julliard <laurent@...>
Hi,
Laurent Julliard wrote:
Joel VanderWerf wrote:
[#294711] WWW::Mechanize and basic_auth — "Todd A. Jacobs" <tjacobs-sndr-019fdb@...>
I'm trying to get basic authentication to work with Ruby 1.8 and
Hi Todd.
On Sun, Mar 16, 2008 at 12:27:21PM +0900, saronpasu wrote:
[#294718] Looking for an appropiate parser generator — Iñaki Baz Castillo <ibc@...>
Hi, I'm new in this maillist so hello to all.
On 15 Mar 2008, at 23:21, Iki Baz Castillo wrote:
[#294740] ruby-mode.el and tabbing — "Frank Wilson" <fajwilson@...>
I'm starting to learn RoR on emacs with the ecb and rails plugins.
[#294744] Design patterns — Daniel Mendler <dmendler@...>
Hi,
On Mar 16, 2008, at 7:25 AM, Daniel Mendler wrote:
James Gray wrote:
James Gray wrote:
[#294746] argh! more undocumented mysteries: to_yaml — Tom Cloyd <tomcloyd@...>
Beginner woes, here, no doubt, but woes nevertheless.
I'm beginner to but I understand it. You cannot use to_yaml for Array,
Documentation? WHAT documentation? Please read my email.
Tom Cloyd wrote:
Phillip Gawlowski wrote:
Tom Cloyd wrote:
Phillip Gawlowski wrote:
On Sunday 16 March 2008, Tom Cloyd wrote:
Stefano Crocco wrote:
Dave Thomas wrote:
[#294792] returning text between two markers without markers included — Adam Akhtar <adamtemporary@...>
On Mar 16, 2008, at 21:02 , Adam Akhtar wrote:
Thanks Xavier,
On Mar 16, 2008, at 21:23 , Adam Akhtar wrote:
ahhh thats great. I like the readability one. ill be using that a lot
I just wondered, if I had multiple marked sections in a string how would
On Sun, Mar 16, 2008 at 4:59 PM, Adam Akhtar <adamtemporary@gmail.com> wrote:
[#294819] Cipher — Max Zhou <ball908765@...>
I am trying to make a program that takes what you input, and encrypts it by turning a to p, b to q, z to b, etc. It moves the letter 2 spaces to the left (a to c) and moves it down (c to p). (See below.) Even though you can just say that a will be n, how do you seperate each letter and turn it into a string? Please put it in terms that a Ruby beginner would understand.
[#294828] For Comment: Gem Browser — "s.ross" <cwdinfo@...>
It occurred to me that the way I was finding Gems was by making notes
On Mon, Mar 17, 2008 at 4:20 AM, s.ross <cwdinfo@gmail.com> wrote:
On Mon, Mar 17, 2008 at 12:20:54PM +0900, s.ross wrote:
On Tue, Mar 18, 2008 at 02:53:54PM +0900, Chad Perrin wrote:
On Mar 17, 2008, at 11:11 PM, Chad Perrin wrote:
On Tue, Mar 18, 2008 at 04:59:00PM +0900, s.ross wrote:
Hi--
[#294836] Problem with Webrick/HTTProxy — Yangsu Kim <nrimbo@...>
I installed ruby 1.8.6 for Windows(Vista Home Premium).
[#294848] How to make an unix library from some ruby code? — Pavel Smerk <smerk@...>
Hello *,
> I need to have some functionality "packaged" as an unix library
[#294849] Ruby "Speedup" hints? — Marc Heiler <shevegen@...>
Anyone of you has a few hints on how to speed up ruby code?
On Mon, 17 Mar 2008 14:01:51 +0100, Robert Klemme wrote:
2008/3/17, Ken Bloom <kbloom@gmail.com>:
Hi there,
On Mon, Mar 17, 2008 at 12:42 PM, Marc Heiler <shevegen@linuxmail.org> wrote:
On Tue, Mar 18, 2008 at 02:17:22AM +0900, Gerardo Santana G?mez Garrido wrote:
On Mon, Mar 17, 2008 at 6:08 PM, Paul Brannan <pbrannan@atdesk.com> wrote:
On Tue, Mar 18, 2008 at 02:40:43PM +0900, Gerardo Santana G?mez Garrido wrote:
[#294859] Test for Internet Connection — Cory Cory <cg821105@...>
Does anyone know a way to test to see if the computer is connected to
I usually do something like this on my machine
Roger Pack wrote:
On Mon, Mar 17, 2008 at 11:08 AM, Cory Cory <cg821105@ohio.edu> wrote:
> use the NetworkManager D-Bus interface. I believe there is a D-Bus
On Mon, Mar 17, 2008 at 12:45 PM, Cory Cory <cg821105@ohio.edu> wrote:
Avdi Grimm wrote:
[#294898] Any good Ruby/Qt4 tutorials? — "ben baka" <brainychip@...>
I have been searching around for some good tutorials on Ruby/Qt4 tutorials.
[#294902] Parallel Execution of Unit Tests — wade <onlywade@...>
Hi,
[#294903] Interbase driver problems XP — Oniram Atila <oniram@...>
I am trying to compile the ruby Interbase module, but failing.
On Mon, Mar 17, 2008 at 9:52 PM, Oniram Atila <oniram@gmail.com> wrote:
[#294911] CGI and Methods?? — Tony De <tonydema@...>
Hi all,
[#294914] SQLite3 Compilation issue — mt <mutahhir.ali@...>
Hey guys,
[#294922] What does &&= do? — Subbu <subramani.athikunte@...>
I came across &&= while reading some code. I know what ||= does but
[#294924] Issue with SQL like — "Rajat Garg" <rajat79@...>
Hi Guys,
[#294928] about timer? — Pat Kiatchaipipat <hb.pat87@...>
hi, I have problem about timer that I want to use with Wxruby.
[#294972] win32 File.size slow? — "Nation, Carey" <Carey.Nation@...>
Last week I posted a question about incorrect file sizes coming back
[#295009] Need help with singleton! — Diego Bernardes <di3go.bernardes@...>
Hi :)
[#295014] Google Summer of Code 2008? — "Chiyuan Zhang" <pluskid@...>
Hi,
[#295018] Undefined method '<' for nil:NilClasse — Roberto Casadei <robyonrails@...>
This is the code:
[#295023] Split string at spaces, but not when inside quotation marks? — Peter Bunyan <peter.bunyan@...>
I want to be able to split a string at the space, unless the spaces are
[#295024] regexp conditional — ciapecki <ciapecki@...>
Hi,
[#295033] Problem in using typedef with c++ — Abhi Us <abhishek.v@...>
Hi
[#295041] using system to echo "hello world" gives SystemStackError — Thufir <hawat.thufir@...>
I can't fathom this error regarding the stack:
[#295052] Status of mod_ruby now ....? — Web Reservoir <webreservoir@...>
Hi,
[#295053] Inspetting a method's caller — Alberto Santini <santini.alberto@...>
Hello.
I've always seen that whenever you need something like this, there's
> but you can make the caller send in an extra argument, putting its
[#295094] I HATE SPAM — Stedwick <philip.brocoum@...>
Where is all the spam coming from lately?
[#295113] Pushed a new beta of PickAxe 3 — Dave Thomas <dave@...>
I've just finished a first pass through the built-in library reference
Dave Thomas wrote:
[#295125] Invoking a windows application (e.g notepad) from ruby — Anukul Singhal <anukul.singhal@...>
Hi,
[#295128] DevLib: Sharing Library Development Expertise — "Matt Todd" <chiology@...>
= DevLib
[#295141] getting the user's home directory path — Chad Perrin <perrin@...>
I've got a program that needs to access a file in the ~/etc/ directory.
[#295150] combine array(string) to string? — Pat Kiatchaipipat <hb.pat87@...>
str= "ABCDE"
On Thu, Mar 20, 2008 at 4:44 AM, Pat Kiatchaipipat <hb.pat87@hotmail.com> wrote:
On 20.03.2008 11:49, Todd Benson wrote:
[#295173] if-less if statements — Shandy Nantz <shandybleu@...>
I asked this on the rails side of this forum but didn't get a response
Hi Shandy,
[#295178] Can I write text to a notepad and save the file through ruby — Anukul Singhal <anukul.singhal@...>
Hi,
[#295181] Find.find sorting: files before directories — Adam Boyle <briefcase.speakers@...>
I'm looking for a simple way to use Find.find to produce a list of
[#295184] extending ruby with C++ — 7stud -- <bbxx789_05ss@...>
I'm using this old (2001) mini tutorial:
Try using g++ to link the code rather than cc. Using cc does not
7stud -- wrote:
Thanks for the response.
[#295195] Win32Ole, MAPI, and Outlook — Jeff Miller <loadeddesigns@...>
Hello Everybody,
[#295198] How to change the Timeout::Error threshold for open_uri — Keith Carter <kmarplecarter@...>
When opening a particularly slow loading URL I am getting the following
[#295206] test-unit 1.2.3 Released — Ryan Davis <ryand-ruby@...>
[#295212] including instance methods and setting an instance variable — Leon Bogaert <leon@...>
Hi all,
Hi --
Thanks for the clear explanation David!
Can I "connect" with the instance if it get's instanciated? Because I
On 21.03.2008 11:15, Leon Bogaert wrote:
Thanks Robert!
This guy: http://www.ruby-forum.com/topic/142444
Hi --
Ah thanks David.
On 22.03.2008 09:34, Leon Bogaert wrote:
On Sat, Mar 22, 2008 at 11:34 AM, Robert Klemme
On 22.03.2008 13:43, Robert Dober wrote:
> > I am very confused by this thread
On 3/22/08, Robert Dober <robert.dober@gmail.com> wrote:
On Sat, Mar 22, 2008 at 7:42 PM, Rick DeNatale <rick.denatale@gmail.com> wrote:
On 3/22/08, Robert Dober <robert.dober@gmail.com> wrote:
[#295213] Dealing properly with scope; came from:combine array(string) to string? — "Todd Benson" <caduceass@...>
In much of my code, I've built an Array object before a block for
You can usually use inject or collect to eliminate the a = [] line.
[#295220] Calling super with no arguments — "Daniel Finnie" <dan@...>
Hi all,
[#295233] Is license of gserver.rb in Ruby package "freeware"?? Thanks. — "XiaoLiang Liu" <liuxlsh@...>
Hello,
quoth the XiaoLiang Liu:
On Fri, Mar 21, 2008 at 12:16 AM, darren kirby <bulliver@badcomputer.org> wrote:
quoth the Avdi Grimm:
Yes, since gserver.rb is part of ruby core, I think it might need be
[#295263] A question involving variable evaluation — mike leonard <mikeleonard@...>
Hello friends,
[#295264] making an exe — HadsS <a.hadss@...>
heya.. im new to this ruby language and wanted to know how can i make
[#295271] Newbie question : private / public methods — "krzysieq Gazeta.pl" <krzysieq@...>
Hi,
On Friday 21 March 2008, krzysieq Gazeta.pl wrote:
Then it enforces habits, which I've been encouraged to develop anyways - my
[#295288] dynamically defining a method on an instance that references vars in enclosing scope? — "Christopher J. Bottaro" <cjbottaro@...>
Hello. I want to do this.
Hi --
The problem is of scope. foo is a method belonging to the 'instance'
Hi --
> I know that the problem is scope. That's why I suggested a way to
Hi --
[#295296] ruby19 and defined? — Joel VanderWerf <vjoel@...>
[#295303] Ruby Compiler — Heesob Park <phasis@...>
Hi,
[#295308] Mechanize confusion — "Glen Holcomb" <damnbigman@...>
I will admit I've never used Mechanize before and if I am asking painfully
[#295309] Ruby and 3270 terminal emulation — Daniel Berger <djberg96@...>
Hi all,
[#295324] raven, rake, ant and ruby — Thufir <hawat.thufir@...>
I don't really know how to put these together. What I do know is that my
[#295352] ruby object databases — Sean Allen <sean@...>
Google fails me.
[#295370] Ruby and Facebook marketing — "Kyrre Nyg蚌d" <kyrreny@...>
Hey,
[#295377] XCode, Mac OS X, Ruby C Extension — Wladjmir Wlj <wladjmir@...>
Hi,
[#295380] #meta — Trans <transfire@...>
I've come across a number of occasions where methods like
On 22.03.2008 14:15, Trans wrote:
Hi Robert,
[#295398] Any Idea? — Eder Quiñones <eder.sq@...>
How to make something similar to this kind of stuff(the highlighted
On Sat, Mar 22, 2008 at 6:33 PM, Eder Quines <eder.sq@gmail.com> wrote:
[#295443] Sytem hook for instance names? — Jeff Patterson <jeff_patterson@...>
Is there a system hook that allows a method to get an instance's symbol
On 23.03.2008 16:15, Jeff Patterson wrote:
Jeff Patterson wrote:
On 23.03.2008 19:30, Mark Bush wrote:
[#295468] Rich Graphic Interface with Ruby — Diego Bernardes <di3go.bernardes@...>
What is the best way to get a really nice gui in ruby?
Diego Bernardes wrote:
M. Edward (Ed) Borasky wrote:
[#295472] Bootstrapping Ruby with MinGW: selfhosted and test sandbox! — Luis Lavena <luislavena@...>
Hello List,
On 28/03/2008, Joel VanderWerf <vjoel@path.berkeley.edu> wrote:
[#295476] functions, arguments and changing their value permantently — Adam Akhtar <adamtemporary@...>
Im coming over to Ruby from C++ after a long break from programming. One
On 3/24/08, Adam Akhtar <adamtemporary@gmail.com> wrote:
[#295483] Question about Array#* — Magicloud Magiclouds <magicloud.magiclouds@...>
Hello,
[#295500] Beginner's question — Peter Johnsson <avokadoret@...>
This question may be a bit too "simple" for this forum which seems to
On Mar 24, 2008, at 9:05 AM, Peter Johnsson wrote:
[#295509] $stdin — Stefan Gremm <sgremm@...>
Hello,
[#295529] Rubybrain.com — Zoop Zoop <manuel.meurer@...>
I am really confused by rubybrain.com.
[#295532] optionparser to gui automation? — "Mark Noworolski" <jmarkn@...>
I'm looking to support functionality like follows:
You're probably looking for something like this:
[#295566] Ruby? — Gib Let <kineas.lontor@...>
I am currently in the planning process of making a website, and I have
[#295572] Ruby GSoC 2008 now accepting student applications — "pat eyler" <pat.eyler@...>
Google has just turned on the student application web page. If you're
Where can I find links or email address to contact the the potential
On Tue, Mar 25, 2008 at 5:03 AM, Chiyuan Zhang <pluskid@gmail.com> wrote:
2008/3/25, pat eyler <pat.eyler@gmail.com>:
[#295575] Replacing part of a matched regular expression using gsub — Ben <coppin@...>
Hi,
[#295591] generating unique random numbers — Jimmy Palmer <modernfossil@...>
I'm trying to generate 8 unique random numbers between 1 and 13.
Jimmy Palmer wrote:
Tim Hunter wrote:
Jimmy Palmer wrote:
On Tue, Mar 25, 2008 at 10:26 AM, Tim Hunter <TimHunter@nc.rr.com> wrote:
[#295600] First use of debugger weird — RichardOnRails <RichardDummyMailbox58407@...>
Hi,
[#295604] Passing params to Map method — Ruby Freak <twscannell@...>
Hi and thanks in advance for your help.
[#295605] thread.rb — "Adam Bender" <abender@...>
I want to modify the Queue class in thread.rb, so I first searched for
2008/3/25, Adam Bender <abender@gmail.com>:
On Tue, 25 Mar 2008 12:32:38 +0900, "Adam Bender" <abender@gmail.com> wrote:
On Tue, Mar 25, 2008 at 2:01 PM, MenTaLguY <mental@rydia.net> wrote:
[#295606] hash of arrays - appending to one of the arrays — Adam Akhtar <adamtemporary@...>
Hi Ive done a search on this and there have been quite a few posts which
Hi --
[#295609] how to invoke a rake file — Thufir <hawat.thufir@...>
How is this rakefile invoked?
[#295615] Why git instead of mercurial? — "John Wells" <lists@...>
It seems like the hot new thing these days in Ruby-land is to host
On 25 mar, 11:15, Robert Dober <robert.do...@gmail.com> wrote:
I really don't think the internal implementation has that much
Matt Todd wrote:
Hi,
Yukihiro Matsumoto wrote:
Hi,
On Wed, Mar 26, 2008 at 9:54 PM, Yukihiro Matsumoto <matz@ruby-lang.org> wrote:
I find it funny that your only point of comparison between git and
On 25 mar, 06:52, John Wells <li...@sourceillustrated.com> wrote:
On Tue, Mar 25, 2008 at 2:45 PM, Wincent Colaiuta <win@wincent.com> wrote:
[#295627] Kirbybase problem — Tom Cloyd <tomcloyd@...>
Jamey,
[#295629] numbers of a record in an array — Bu Mihai <mihai.bulhac@...>
a have an array array=["a","b","c","a","b"]
On Tue, Mar 25, 2008 at 10:09 AM, Bu Mihai <mihai.bulhac@yahoo.com> wrote:
2008/3/25, Jes俍 Gabriel y Gal疣 <jgabrielygalan@gmail.com>:
On Tue, Mar 25, 2008 at 11:23 AM, Robert Klemme
2008/3/25, Jes俍 Gabriel y Gal疣 <jgabrielygalan@gmail.com>:
If you install the facets gem you can use "frequency"
[#295661] Pros and Cons of Ruby vs JRuby for GUI — "Victor Reyes" <victor.reyes@...>
Although I have been using Ruby for awhile, I am really a beginner as I use
[#295678] Help parsing and extracting a num — "Iñaki Baz Castillo" <ibc@...>
Hi, I'm trying to extract a num from a string. This string is in fact
[#295685] multi-dimentional array — Joan Gu <joan2kus@...>
I need to insert Broad Category value and Topics value into a table,
[#295704] Problem creating war file with warbler — Thomas Kellerer <YQDHXVLMUBXG@...>
Hi,
net/ldap is native code, so you can't run that on jruby yet.
[#295712] remove regex matched line question — Ikuta Lin <ikuta_lin@...>
I wrote the code to query a txt file, and tried remove matched line like
Try to use String#chop or String#chomp
You're not rejecting anything complicated, so it is just as easy to
[#295714] Is possible Ruby to use CRLF instead of LF? — "Iñaki Baz Castillo" <ibc@...>
Hi, AFAIK Ruby uses LF = \n to detect newline. But now I'm coding a
[#295760] gem problem — Elton Okada <eltonokada@...>
i installed atom-tools
[#295761] golf: tabs to bullets — "Martin DeMello" <martindemello@...>
Given:
On Mar 25, 2008, at 4:02 PM, Martin DeMello wrote:
[#295767] mysql database access! possible without rails? — PB0711 <hpbenton@...>
Hello all, again,
[#295826] sorting text in a file — Adam Akhtar <adamtemporary@...>
Hi Ive been hacking away at this all morning and getting nowhere fast.
[#295828] INTERPRETED LANGUAGE — Jitendra Rai <jitendra.vinsol@...>
IS IT NECESSARY FOR AN INTERPRETED LANGUAGE TO BE CASE SENSITIVE?
On Wed, 26 Mar 2008 01:25:36 -0500, Jitendra Rai wrote:
[#295838] private(true) || private :make_time, what does it do? why? — Rie! <ariekusumaatmaja2@...>
i found that rake source has got this strange one line of code
From: Rie! [mailto:ariekusumaatmaja2@gmail.com]
[#295854] The inject function — Shendelzare Silkwood <zerruellx@...>
I want to add together numbers in an array with the inject command. I
[#295876] "loop do IO.select([io], nil, nil)" eats 95% of CPU, any other way? — "Iñaki Baz Castillo" <ibc@...>
Hi, which is the most efficient way of receiving and processing data
On Thu, 27 Mar 2008, I単aki Baz Castillo wrote:
El Mi辿rcoles, 26 de Marzo de 2008, John Carter escribi坦:
On Thu, 27 Mar 2008, Iñaki Baz Castillo wrote:
On Wed, Mar 26, 2008 at 10:34 AM, I単aki Baz Castillo <ibc@aliax.net> wrote:
2008/3/27, Marcelo <marcelo.magallon@gmail.com>:
2008/3/27, I単aki Baz Castillo <ibc@aliax.net>:
[#295881] Sun's Overview of Ruby and JRuby — Veloso <starlover@...>
A very good article
On Thu, 27 Mar 2008 02:34:54 +0900, Veloso wrote:
thufir wrote:
On 02/04/2008, Charles Oliver Nutter <charles.nutter@sun.com> wrote:
[#295899] Encode as alphanumeric — Trans <transfire@...>
Hi,
On Thu, 27 Mar 2008 05:13:23 +0900, Trans <transfire@gmail.com> wrote:
[#295918] fork — "Joey Marino" <joey.da3rd@...>
I want to fork a child process and use instantiated objects from the parent
[#295930] Exports quality scaffolding and scaffolding from China — Jack Wu <dscaffold@...>
Wuxi Direct scaffolding & Metal hardware Co.,Ltd China is one leading
[#295944] instance_variable_[gs]et — Trans <transfire@...>
Just spinning wheels this evening...
-----BEGIN PGP SIGNED MESSAGE-----
On 27.03.2008 16:28, Trans wrote:
[#295947] Is this a threading bug in Ruby-185-21 on Win32? — "Just Another Victim of the Ambient Morality" <ihatespam@...>
I'm trying to write a program that will poll some website and that is
[#295948] Over Loading — Selvaraj Subbaian <selvaraj@...>
Hai All,
[#295950] embedding ruby (*not* extending) — John Smith <ka5427-536@...>
I need to embed a scripting languange in a C++ application.
[#296001] How to kill a Thread into GServer "def server(io)" method? — "Iñaki Baz Castillo" <ibc@...>
Hi, I'm using GServer and in "serve" method I read a string from a TCP socket:
[#296002] pypes — "Martin DeMello" <martindemello@...>
http://www.voidspace.org.uk/python/weblog/arch_d7_2008_03_22.shtml#e954
[#296039] How to make an installer for an FXRuby app? — Daniel Wilkerson <daniel.wilkerson@...>
I have FXRuby working on OS X. If I write an app in Ruby/FXRuby and get
[#296060] multiple rake build files? large rake files — thufir <hawat.thufir@...>
I'm using rake to build small java applications and have hit the ceiling,
[#296063] Web-based games? — Hal Fulton <hal9000@...>
Who's interested in developing a few web-based games?
Hal Fulton wrote:
> Be careful about intellectual property, especially trademarks,
There is a company that produces a whole slew of online games at
I'm currently addicted to BattleMaster (http://www.battlemaster.org)
Eleanor McHugh wrote:
On 30 Mar 2008, at 18:03, M. Edward (Ed) Borasky wrote:
Eleanor McHugh wrote:
> I don't see the point in creating a game that people won't pay money to play.
On Mon, Mar 31, 2008 at 4:10 PM, Marc Heiler <shevegen@linuxmail.org> wrote:
[#296064] hrpicot - cant extract what i want from page — Adam Akhtar <adamtemporary@...>
Hi im starting to use hrpicot and im having problems extracting
On Fri, Mar 28, 2008 at 2:11 AM, Adam Akhtar <adamtemporary@gmail.com> wrote:
thanks tod for the reply. Yes even I thought that it was badly designed
Firebug puts in tbody's into xpath's that reach into tables even if the <tbody> tag is not in the html source. Try removing the tbody path and debug using shorter xpaths to initially address content further up in the hierarchy.
On Fri, Mar 28, 2008 at 11:42 AM, Dan Diebolt <dandiebolt@yahoo.com> wrote:
[#296069] What is the use of :var in ruby — Pradeep Belagapu <pradeep@...>
Hi,
[#296087] error installing libxml — Bu Mihai <mihai.bulhac@...>
i have this error:
[#296093] "gem list" and "sudo gem list" yield different results — Mike Nicholaides <mike.nicholaides@...>
Hey there,
[#296098] Why Ruby do not optimize code at all? — Heesob Park <phasis@...>
Hi,
I think the problem is that you can redefine any method
Hi,
Park Heesob wrote:
ts pisze:
Marcin Mielナシyナгki wrote:
ts wrote:
Marcin Mielナシyナгki wrote:
On Mar 28, 2008, at 9:19 AM, ts wrote:
[#296102] boolean and logging — testautomated6@...
Hi,
[#296122] JRuby on gij — "Michal Suchanek" <hramrach@...>
Hello,
[#296127] Use of gruff, RMAgick for dynamic Graphying — "Victor Reyes" <victor.reyes@...>
Team,
Victor Reyes wrote:
[#296129] Introspecting Method Arguments with Method.arity — Paul Mucur <mudge@...>
Is there a way to return the number of required arguments, the number
[#296142] Boolean Operators — Mark Dodwell <seo@...>
Quick question:
[#296148] Ruby iterating over Exchange Mailboxes — Jeff Miller <loadeddesigns@...>
Hello,
Hello everybody,
On Mon, Mar 31, 2008 at 11:33 PM, Jeff Miller <loadeddesigns@gmail.com> wrote:
[#296149] HTTP GET requests in a Ruby CGI Script — Ben Aroia <benaroia@...>
Website: http://unchartedmess.com/plaingoogle
[#296151] Is ruby is faster than all Object oriented Scripting langs — "bramu.ss@..." <bramu.ss@...>
Hello,
Hi 7Stud,
It does seem a somewhat inflammatory statement to make on this list.
Mark Ryall wrote:
Absolutely - I suspected I might regret posting that statement. It's a bit
On Mar 28, 10:12 pm, Mark Ryall <mark.ry...@gmail.com> wrote:
I really don't understand the extensive dicussions on such a moot point.
mutahhir hayat wrote:
>
mutahhir hayat wrote:
>
On 30 Mar 2008, at 07:42, mutahhir hayat wrote:
[#296152] Injection molding,china plastic, plastic parts, blow molding — David King <plastic@...>
Wuxi Glory Plastic Co.,ltd. was established in 1995,occupying 12,000
[#296156] Google Summer of Code proposal: GRuVeR: A General Ruby library for solving Routing Vehicle Problems — "Nikos D." <demisone@...>
Hi there all, i've just submitted this proposal for this year GSoC and
Nikos D. wrote:
[#296168] CMS application doubts? — Varun Goel <varun.rajeshkumar@...>
Hi All,
[#296173] Help on best way to gather/sort results [Array/Hash]? — Tony De <tonydema@...>
Greetings ruby fans,
On Sat, Mar 29, 2008 at 12:02 AM, Tony De <tonydema@gmail.com> wrote:
Todd Benson wrote:
Tony De wrote:
Wouldn't you want something like @results.sort {|x, y| y[1] <=> x[1]}?
Christian wrote:
Does the sort work if you just put in the sourceip? Say, you did @results <<
Christian wrote:
Tony De wrote:
Hi --
David A. Black wrote:
On Sat, Mar 29, 2008 at 1:55 AM, Tony De <tonydema@gmail.com> wrote:
[#296193] Regular Expression help — Tony De <tonydema@...>
On to my next learning exercise. As I parse a file I need to pull an IP
Hi --
[#296200] rexml to slow — Bu Mihai <mihai.bulhac@...>
I have an xml file and sometimes i call the find_first_recursive method;
On 29.03.2008 08:46, Bu Mihai wrote:
Robert Klemme wrote:
On 30.03.2008 20:23, Bu Mihai wrote:
Robert Klemme wrote:
On 30.03.2008 22:21, Bu Mihai wrote:
Im trying to build a map and to memorize all routes. I have a root node
2008/3/31, Bu Mihai <mihai.bulhac@yahoo.com>:
and what do you recomand?
2008/3/31, Bu Mihai <mihai.bulhac@yahoo.com>:
Robert Klemme wrote:
I believe the core problem is that XML itself is pretty sub-optimal for
[#296205] RubyGems 1.1.0 — Eric Hodel <drbrain@...7.net>
= Announce: RubyGems Release 1.1.0
Eric Hodel <drbrain@segment7.net> wrote:
[#296221] stumped — Jeff Patterson <jeff_patterson@...>
I'm learning ruby by writing a hardware simulator. Since the users will
[#296234] punch-0.0.2 - i can has time tracking — ara howard <ara.t.howard@...>
[#296244] What's going on here? (weird Ruby 1.9 incompatibility) — "Tony Arcieri" <tony@...>
class A
On Sat, Mar 29, 2008 at 12:08 PM, Tony Arcieri <tony@medioh.com> wrote:
[#296246] RMagick 2.3.0 — Tim Hunter <TimHunter@...>
I've just uploaded RMagick 2.3.0. This release adds two new methods to
Thanks for the great work!
David Scheffel wrote:
> RMagick is a volunteer effort.
[#296262] Improvements to RDoc (ideas for GSoC) — Rodrigo Almeida <rsalmeidafl@...>
I'm a brazilian student wishing to participate in Google Summer of
On Mar 29, 2008, at 14:20 PM, Rodrigo Almeida wrote:
Is this new RDoc on Github or somewhere that I can get to? I'd be
[#296271] Extrange behaviour using "if XXX ..." and "XXX if ..." — Iñaki Baz Castillo <ibc@...>
Hi, note the difference in those both cases:
I単aki Baz Castillo wrote:
[#296272] remote ip address — Ben Aroia <benaroia@...>
I am going to be using a simple ip limiting system on a site I'm working
El Domingo, 30 de Marzo de 2008, Ben Aroia escribi坦:
I単aki Baz Castillo wrote:
[#296273] Unit test filename convention — Manlio Malaidini <mmalaidini@...>
All,
[#296297] how-to unmixin a module — David Beckwith <dbitsolutions@...>
Hi,
[#296306] inject's pathological case... — "Just Another Victim of the Ambient Morality" <ihatespam@...>
I'm not sure how I feel about inject's pathological case. What do you
Just Another Victim... wrote:
Oh, yeah:
On 3/30/08, 7stud -- <bbxx789_05ss@yahoo.com> wrote:
> Understand that it's a way to reduce/fold the elements
On Sun, Mar 30, 2008 at 10:30 AM, Marc Heiler <shevegen@linuxmail.org> wrote:
Hi --
Hi,
[#296326] instance variable access — Trans <transfire@...>
After hee-hawing about with Facets' instance variable extension
On Sun, Mar 30, 2008 at 1:05 PM, Trans <transfire@gmail.com> wrote:
[#296327] mark, alloc and free functions in C extensions — "Gerardo Santana Gez Garrido" <gerardo.santana@...>
I have a class A written in C that contains a C structure. I have
[#296363] Ruby 1.9 named arguments — "bparanj@..." <bparanj@...>
When I run the following in the irb session, I am getting an error.
[#296375] GC help — "Joey Marino" <joey.da3rd@...>
I am still running out of memory with my ruby application. For some reason,
Joey Marino wrote:
I found out it is not the 3rd party code. I am downloading images (~320,000
Joey Marino wrote:
On 31/03/2008, Tim Hunter <TimHunter@nc.rr.com> wrote:
[#296380] How to uninstall locally installed ruby? — "Artem Voroztsov" <artem.voroztsov@...>
Linux.
[#296411] log_buddy released - your helpful dev and debug buddy — "Rob Sanheim" <rsanheim@...>
LogBuddy is your friendly little log buddy at your side, helping you
[#296413] ruby and rdebug — barjunk <barjunk@...>
I'm running a ruby script like so:
[#296419] Create A Distributable Ruby Program With Minimal Install — Wesley Rishel <wes.rishel@...>
Although I have started to use Ruby instead of Python, I very much miss
Hey Wesley,
This question keeps on appearing over time :)
[#296424] Write data into Excel Sheet — Pranjal Jain <pranjal.jain123@...>
Hi I am new to Ruby.
[#296434] Is it me or Math::sqrt? — Phillip Gawlowski <cmdjackryan@...>
-----BEGIN PGP SIGNED MESSAGE-----
2008/3/31, Phillip Gawlowski <cmdjackryan@googlemail.com>:
-----BEGIN PGP SIGNED MESSAGE-----
[#296442] Hash insertion order preservation in ruby1.9 — Joachim (Mchen) <wuttke1@...>
I am glad to see that ruby1.9.0 preserves hash insertion order.
[#296445] Re: how to restart the system with our code — Damjan Rems <d_rems@...>
Vamsi Krishna wrote:
[#296456] Instant Messenger?? — Pat Kiatchaipipat <hb.pat87@...>
Hello. I want use Ruby to make Instant Messenger. Where can I study
[#296457] Problems installing RRDtool gem under Windows — "Victor Reyes" <victor.reyes@...>
Team,
On Mon, Mar 31, 2008 at 2:58 PM, Victor Reyes <victor.reyes@gmail.com> wrote:
[#296462] Why my posts appear twice? — "Victor Reyes" <victor.reyes@...>
Team,
[#296477] Primes in P? — Charles Zheng <snarles2@...>
There is an algorithm that tests primes with a polynomial running time:
Charles Zheng wrote:
Michael Brooks wrote:
[#296485] Displaying gruff graphs — "Victor Reyes" <victor.reyes@...>
Team,
Victor Reyes wrote:
Mark, thank you for your answer and time.
I finally got this working with wx by hard-coding the file path. The graphs
Victor Reyes wrote:
[#296488] metrics rmagick problem — Eduard Bondarenko <edbond@...>
I get a strange rmagick result.
[#296503] sockets, windoze, and threads — ara howard <ara.t.howard@...>
[#296505] new user problem about xmpp4r — Pat Kiatchaipipat <hb.pat87@...>
Hi. I'm mew user of xmpp4r. After I install xmpp4r and xmpp4r-sample
[#296512] Modifying FIX::* method — Alex DeCaria <alex.decaria@...>
I have a class such as
[#296543] Suggest alternatives for Facets paramix? — "Jacob Burkhart" <igotimac@...>
I Can't seem to find any documentation or explanation as to why paramix has
Re: eliminate duplicate sequences from file
On Feb 29, 9:21 pm, Esmail <ebonak_de...@hotmail.com> wrote:
> A few months back I asked for suggestions to parse a file that
> contained this type of data:
>
> >label_1
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> TT
> >label_2
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> CC
> >label_3
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> GG
> >label_4
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> AA
> >label_5
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> AAACCCCCCCTTTTTAAAAA
> GG
>
> I wanted to eliminate duplicate sequences. This is what I ended up
> using based on some great suggestions here:
>
> -------------
>
> def no_dups(data)
> data.split(">").uniq.join(">")
> end
>
> data = IO.read(ARGV[0])
> fixed = no_dups(data)
> puts fixed
>
> -------------
>
> However, I have discovered a problem with the data. While the labels
> may be different (and have different lengths, like the sequence may -
> tough my simplified example doesn't), the associated sequences may
> indeed be *identical*.
>
> So for instance the sequences associated with label_3 and label_5 are
> in fact identical, but will not be flagged as such since their labels
> differs.
>
> My goal is to eliminate duplicate sequences (and their label) from
> this file. So in this case either label_3 and its sequence, or label_5
> and its sequence would be eliminated. Does anyone have a good
> suggestion on how to accomplish this?
>
> My initial thought is to somehow parse the file and create a hash and
> then use the sequences as keys and the labels as values, the idea
> being that duplicate sequences (ie keys) would overwrite each other if
> they occurred and I'd end up with all unique sequences.
>
> Does this seem like a reasonable approach. Is there a better, more
> elegant and perhaps more efficient solution?
>
> Thanks!
>
> eb
Sounds like a good idea.
h = Hash[ *DATA.read.split( /^( *>label_\d+\n)/ )[1..-1].reverse ]
puts h.to_a.flatten.reverse
__END__
>label_1
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
TT
>label_2
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
CC
>label_3
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
GG
>label_4
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
AA
>label_5
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
AAACCCCCCCTTTTTAAAAA
GG